Sciencemadness Discussion Board
Not logged in [Login - Register]
Go To Bottom

Printable Version  
Author: Subject: The Iron Binding Integrase
Vmedvil
Banned for blowing margins instead of minds...





Posts: 42
Registered: 4-9-2017
Member Is Offline

Mood: No Mood

[*] posted on 17-12-2017 at 17:56
The Iron Binding Integrase


This was a protein hybrid from long ago which May or may not work, Iron Binding Integrase, which is Integrase from HIV which usually binds to DNA which instead has been reengineered to bind to Iron with the part of Hemoglobin that binds to Iron in blood cells.

Integrase with DNA bound to it.



Hemoglobin with Iron in it.


hhemo_rib1.jpg - 96kB


Iron Binding Integrase.




The only thing about this is you never know if it will work or not until physically tested with Splicing proteins together, the Code may say that it Is the same as when they were apart, but will it still fold the same way maybe not.

Iron Binding Integrase DNA Code.

Integrase without part of Red Region with Hemoglobin section 2

atggtgctgagcccggcggataaaaccaacgtgaaagcggcgtggggcaaagtgggcgcg
catgcgggcgaatatggcgcggaagcgctggaacgcatgtttctgagctttccgaccacc
aaaacctattttccgcattttgatctgagccatggcagcgcgcaggtgaaaggccatggc
aaaaaagtggcggatgcgctgaccaacgcggtggcgcatgtggatgatatgccgaacgcgctgagcgcgctgagcgatctgcatgcgcataaactgcgcgtggatccggtgaactttaaa
ctgctgagccattgcctgctggtgaccctggcggcgcatctgccggcggaatttaccccg
gcggtgcatgcgagcctggataaatttctggcgagcgtgagcaccgtgctgaccagcaaa
tatcgcaac tagcagacca actaattcat ctgtattactttgactgttt ttcagactct gctataagaa aggccttatt aggacacata gttagccctaggtgtgaata tcaagcagga cataacaagg taggatctct acaatacttg gcactagcagcattaataac accaaaaaag ataaagccac ctttgcctag tgttacgaaa ctgacagaggatagatggaa caagccccag aagaccaagg gccacagagg gagccacaca atgaatggac


[Edited on 18-12-2017 by Vmedvil]
View user's profile View All Posts By User

  Go To Top